target name | Alignment | Expection | Target Description | Target type | Method |
TC38817 | | ncRNA: | 20 | CCCUUACUUCGGACCAGGCU | 1 | | | | ||||*|*|||||*||||||| | | | targets: | 469 | GGGAUUCAAGCCGGGUCCGA | 488 |
| 3 | similar to UniRef100_Q9ZP40 Cluster: Plastoglobulin-1, chloroplast precursor; n=1; Pisum sativum|Rep: Plastoglobulin-1, chloroplast precursor - Pisum sativum (Garden pea), partial (56%) | coding gene | psRNATarget[Detail] |
TC43711 | | ncRNA: | 20 | CCCUUACUUCGGACCAGGCU | 1 | | | | ||||*|*|||||*||||||| | | | targets: | 402 | GGGAUUCAAGCCGGGUCCGA | 421 |
| 3 | similar to UniRef100_Q9ZP40 Cluster: Plastoglobulin-1, chloroplast precursor; n=1; Pisum sativum|Rep: Plastoglobulin-1, chloroplast precursor - Pisum sativum (Garden pea), partial (70%) | coding gene | psRNATarget[Detail] |
|